Multifaceted Applications of Luminescent Metalloporphyrin Derivatives: Fluorescence Turn-On Sensing of Nicotine and Antimicrobial Activity.

In this study, we designed and synthesized metalloporphyrin derivatives (with Ni and Zn) specifically intended for the fluorescence detection of nicotine in aqueous solutions. Our results showcased a notable selectivity for nicotine over other naturally occurring food toxins, exhibiting an exceptional sensitivity with a limit of detection as low as 7.2 nM. Through mechanistic investigations (1H NMR, FT-IR, etc.), we elucidated the binding mechanism, revealing the specific interaction between the pyridine ring of nicotine and the metal center, while the N atom pyrrolidine unit engaged in the hydrogen bonding with the side chain of the porphyrin ring. Notably, we observed that the nature of the metal center dictated the extent of interaction with nicotine; particularly, Zn-porphyrin demonstrated a superior response compared to Ni-porphyrin. Furthermore, we performed the quantitative estimation of nicotine in commercially available tobacco products. Additionally, we conducted the antibacterial (Staphylococcus aureus and Escherichia coli) and antifungal (Candida albicans) activities of the porphyrin derivatives.

Resonance Raman study of oxoiron(IV) porphyrin π-cation radical complex: Porphyrin ligand effect on ν(Fe=O) frequency.

Resonance Raman (rR) spectroscopy has been applied to study the nature of the iron-oxo (Fe=O) moiety of oxoiron(IV) porphyrin π-cation radical complex (CompI). While the axial ligand effect on the nature of the Fe=O moiety has been studied with rR spectroscopy, the porphyrin ligand effect has not been studied well. Here, we investigated the porphyrin ligand effect on the Fe=O moiety with rR spectroscopy. The porphyrin ligand effect was modulated by the electron-withdrawing effect of the porphyrin substituent at the meso-position. This study shows that the frequency of the Fe=O stretching band, ν(Fe=O), hardly change even when the electron-withdrawing effect of the porphyrin substituent changes. This result is further supported by theoretical calculation of CompI. The natural atomic charge analysis reveals that the oxo and axial ligands work to buffer the electron-withdrawing effect of the porphyrin substituent. The electron-withdrawing porphyrin substituent shifts an electron population from the ferryl iron to the porphyrin, but the decreased electron population on the ferryl iron is compensated by the shift of the electron population from the oxo ligand and the axial ligand. The shift of the electron population makes the Fe-axial ligand bond length short, but the Fe=O bond length unchanged, resulting in the invariable ν(Fe=O) frequency.

Fluorescence lifetime imaging and phasor analysis of intracellular porphyrinic photosensitizers applied with different polymeric formulations.

The fluorescence lifetime of a porphyrinic photosensitizer (PS) is an important parameter to assess the aggregation state of the PS even in complex biological environments. Aggregation-induced quenching of the PS can significantly reduce the yield of singlet oxygen generation and thus its efficiency as a medical drug in photodynamic therapy (PDT) of diseased tissues. Hydrophobicity and the tendency to form aggregates pose challenges on the development of efficient PSs and often require carrier systems. A systematic study was performed to probe the impact of PS structure and encapsulation into polymeric carriers on the fluorescence lifetime in solution and in the intracellular environment. Five different porphyrinic PSs including chlorin e6 (Ce6) derivatives and tetrakis(m-hydroxyphenyl)-porphyrin and -chlorin were studied in free form and combined with polyvinylpyrrolidone (PVP) or micelles composed of triblock-copolymers or Cremophor. Following incubation of HeLa cells with these systems, fluorescence lifetime imaging combined with phasor analysis and image segmentation was applied to study the lifetime distribution in the intracellular surrounding. The data suggest that for free PSs, the structure-dependent cell uptake pathways determine their state and emission lifetimes. PS localization in the plasma membrane yielded mostly monomers with long fluorescence lifetimes whereas the endocytic pathway with subsequent lysosomal deposition adds a short-lived component for hydrophilic anionic PSs. Prolonged incubation times led to increasing contributions from short-lived components that derive from aggregates mainly localized in the cytoplasm. Encapsulation of PSs into polymeric carriers led to monomerization and mostly fluorescence emission decays with long fluorescence lifetimes in solution. However, the efficiency depended on the binding strength that was most pronounced for PVP. In the cellular environment, PVP was able to maintain monomeric long-lived species over prolonged incubation times. This was most pronounced for Ce6 derivatives with a logP value around 4.5. Micellar encapsulation led to faster release of the PSs resulting in multiple components with long and short fluorescence lifetimes. The hydrophilic hardly aggregating PS exhibited a mostly stable invariant lifetime distribution over time with both carriers. The presented data are expected to contribute to optimized PDT treatment protocols and improved PS-carrier design for preventing intracellular fluorescence quenching. In conclusion, amphiphilic and concurrent hydrophobic PSs with high membrane affinity as well as strong binding to the carrier have best prospects to maintain their photophysical properties in vivo and serve thus as efficient photodynamic diagnosis and PDT drugs.

Proximal ligand tunes active site structure and reactivity in bacterial L. monocytogenes coproheme ferrochelatase.

Ferrochelatases catalyze the insertion of ferrous iron into the porphyrin during the heme b biosynthesis pathway, which is fundamental for both prokaryotes and eukaryotes. Interestingly, in the active site of ferrochelatases, the proximal ligand coordinating the porphyrin iron of the product is not conserved, and its catalytic role is still unclear. Here we compare the L. monocytogenes bacterial coproporphyrin ferrochelatase native enzyme together with selected variants, where the proximal Tyr residue was replaced by a His (i.e. the most common ligand in heme proteins), a Met or a Phe (as in human and actinobacterial ferrochelatases, respectively), in their Fe(III), Fe(II) and Fe(II)-CO adduct forms. The study of the active site structure and the activity of the proteins in solution has been performed by UV-vis electronic absorption and resonance Raman spectroscopies, biochemical characterization, and classical MD simulations. All the mutations alter the H-bond interactions between the iron porphyrin propionate groups and the protein, and induce effects on the activity, depending on the polarity of the proximal ligand. The overall results confirm that the weak or non-existing coordination of the porphyrin iron by the proximal residue is essential for the binding of the substrate and the release of the final product.

Refining antimicrobial photodynamic therapy: effect of charge distribution and central metal ion in fluorinated porphyrins on effective control of planktonic and biofilm bacterial forms.

Antibiotic resistance represents a pressing global health challenge, now acknowledged as a critical concern within the framework of One Health. Photodynamic inactivation of microorganisms (PDI) offers an attractive, non-invasive approach known for its flexibility, independence from microbial resistance patterns, broad-spectrum efficacy, and minimal risk of inducing resistance. Various photosensitizers, including porphyrin derivatives have been explored for pathogen eradication. In this context, we present the synthesis, spectroscopic and photophysical characteristics as well as antimicrobial properties of a palladium(II)-porphyrin derivative (PdF2POH), along with its zinc(II)- and free-base counterparts (ZnF2POH and F2POH, respectively). Our findings reveal that the palladium(II)-porphyrin complex can be classified as an excellent generator of reactive oxygen species (ROS), encompassing both singlet oxygen (Φ△ = 0.93) and oxygen-centered radicals. The ability of photosensitizers to generate ROS was assessed using a variety of direct (luminescence measurements) and indirect techniques, including specific fluorescent probes both in solution and in microorganisms during the PDI procedure. We investigated the PDI efficacy of F2POH, ZnF2POH, and PdF2POH against both Gram-negative and Gram-positive bacteria. All tested compounds proved high activity against Gram-positive species, with PdF2POH exhibiting superior efficacy, leading to up to a 6-log reduction in S. aureus viability. Notably, PdF2POH-mediated PDI displayed remarkable effectiveness against S. aureus biofilm, a challenging target due to its complex structure and increased resistance to conventional treatments. Furthermore, our results show that PDI with PdF2POH is more selective for bacterial than for mammalian cells, particularly at lower light doses (up to 5 J/cm2 of blue light illumination). This enhanced efficacy of PdF2POH-mediated PDI as compared to ZnF2POH and F2POH can be attributed to more pronounced ROS generation by palladium derivative via both types of photochemical mechanisms (high yields of singlet oxygen generation as well as oxygen-centered radicals). Additionally, PDI proved effective in eliminating bacteria within S. aureus-infected human keratinocytes, inhibiting infection progression while preserving the viability and integrity of infected HaCaT cells. These findings underscore the potential of metalloporphyrins, particularly the Pd(II)-porphyrin complex, as promising photosensitizers for PDI in various bacterial infections, warranting further investigation in advanced infection models.

ROS-Responsive Bola-Lipid Nanoparticles as a Codelivery System for Gene/Photodynamic Combination Therapy.

The nonviral delivery systems that combine genes with photosensitizers for multimodal tumor gene/photodynamic therapy (PDT) have attracted much attention. In this study, a series of ROS-sensitive cationic bola-lipids were applied for the gene/photosensitizer codelivery. Zn-DPA was introduced as a cationic headgroup to enhance DNA binding, while the hydrophobic linking chains may facilitate the formation of lipid nanoparticles (LNP) and the encapsulation of photosensitizer Ce6. The length of the hydrophobic chain played an important role in the gene transfection process, and 14-TDZn containing the longest chains showed better DNA condensation, gene transfection, and cellular uptake. 14-TDZn LNPs could well load photosensitizer Ce6 to form 14-TDC without a loss of gene delivery efficiency. 14-TDC was used for codelivery of p53 and Ce6 to achieve enhanced therapeutic effects on the tumor cell proliferation inhibition and apoptosis. Results showed that the codelivery system was more effective in the inhibition of tumor cell proliferation than individual p53 or Ce6 monotherapy. Mechanism studies showed that the production of ROS after Ce6 irradiation could increase the accumulation of p53 protein in tumor cells, thereby promoting caspase-3 activation and inducing apoptosis, indicating some synergistic effect. These results demonstrated that 14-TDC may serve as a promising nanocarrier for gene/PDT combination therapy.

Fluorination of porphyrin ß-periphery boosts nickel(II)-catalyzed hydrogen evolution reaction.

Tunichlorin, the naturally occurring chlorophyll cofactor containing Ni(II) ion, sets up a golden standard for designing the electrocatalysts for hydrogen evolution reaction (HER) via ß-peripheral modification. Besides the fine-tuning of the porphyrin ß-periphery such as adjusting the aromatics (the saturated level of tetrapyrrole) or installing hydroxyl group (hydrogen bond network) to enhance the catalytic HER efficiency, here we report that ß-fluorination of porphyrin is also an important approach to increase the reactivity of Ni(II) center. Benefiting the previously reported derivatization of ß-fluorinated porpholactones, we constructed a ß-fluorinated tunichlorin mimic (6). Compared with the non-fluorinated analogs (1, 3, and 5), we found that 2, 4, and 6 exhibit significant electrocatalytic HER reactivity acceleration (in terms of turnover frequencies, TOF, s-1) of ca. 37, 170, 133-fold, respectively. Mechanism studies suggested that ß-fluorination negatively shifts the metal complexes' reduction potentials and accelerates the electron transfer process, both contributing to the boosting of HER reaction. Notably, 6 showed an 890-fold increase of TOFs than 1, demonstrating the combining advantages of the of fluorination, hydrogenation, and hydroxylation at porphyrin ß-periphery.

Could the Length of the Alkyl Chain Affect the Photodynamic Activity of 5,10,15,20-Tetrakis(1-alkylpyridinium-4-yl)porphyrins?

Photodynamic therapy (PDT) is a minimally invasive treatment that uses the combination of a photosensitizing agent (PS) and light to selectively target solid tumors, as well as several non-neoplastic proliferating cell diseases. After systemic administration, PSs are activated by localized irradiation with visible light; in the presence of adequate concentrations of molecular oxygen, this causes the formation of reactive oxygen species (ROS) and subsequent tissue damage. In this study, two series of tetrakis(N-alkylpyridinium-4-yl)porphyrins were synthesized, differing in the presence or absence of a zinc ion in the tetrapyrrole nucleus, as well as in the N-alkyl chain length (from one to twelve carbon atoms). The compounds were chemically characterized, and their effect on cell viability was evaluated using a panel of three tumor cell lines to determine a possible relationship between photodynamic activity and Zn presence/alkyl chain length. The types of cell death mechanisms involved in the effect of the various PSs were also evaluated. The obtained results indicate that the most effective porphyrin is the Zn-porphyrin, with a pendant made up of eight carbon atoms (Zn-C8).

Versatile chondroitin sulfate-based nanoplatform for chemo-photodynamic therapy against triple-negative breast cancer.

Versatile nanoplatform equipped with chemo-photodynamic therapeutic attributes play an important role in improving the effectiveness of tumor treatments. Herein, we developed multifunctional nanoparticles based on chondroitin sulfate A (CSA) for the targeted delivery of chlorin e6 (Ce6) and doxorubicin (DOX), in a combined chemo-photodynamic therapy against triple-negative breast cancer. CSA was chosen for its hydrophilic properties and its affinity to CD44 receptor-overexpressed tumor cells. The CSA-ss-Ce6 (CSSC) conjugate was synthesized utilizing a disulfide linker. Subsequently, DOX-loaded CSSC (CSSC-D) nanoparticles were fabricated, showcasing a nearly spherical shape with an average particle size of 267 nm. In the CSSC-D nanoparticles, the chemically attached Ce6 constituted 1.53 %, while the physically encapsulated DOX accounted for 8.11 %. Both CSSC-D and CSSC nanoparticles demonstrated a reduction-sensitive release of DOX or Ce6 in vitro. Under near-infrared (NIR) laser irradiation, CSSC-D showed the enhanced generation of reactive oxygen species (ROS), improving cytotoxic effects against triple-negative breast cancer 4T1 and MDA-MB-231 cells. Remarkably, the CSSC-D with NIR exhibited the most potent tumor growth inhibition in comparison to other groups in the 4T1-bearing Balb/c mice model. Overall, this CSSC-D nanoplatform shows significant promise as a powerful tool for a synergetic approach in chemo-photodynamic therapy in triple-negative breast cancer.

Photosensitizing effects and physicochemical properties of chlorophyll a derivatives with hydrophilic oligoethylene glycol fragments at the macrocycle periphery.

In this work, screening studies of the cytotoxic effect of chlorins with fragments of di-, tri-, and pentaethylene glycol at the macrocycle periphery in relation to HeLa, A549, and HT29 cells were performed. It is shown that, despite different hydrophobicity, all the compounds studied have a comparable photodynamic effect. The conjugate of chlorin e6 with pentaethylene glycol, which has the lowest tendency to association among the studied compounds with tropism for low density lipoproteins and the best characteristics of the formation of molecular complexes with Tween 80, has a significant difference in dark and photoinduced toxicity (ratio IC50(dark)/IC50(photo) approximately 2 orders of magnitude for all cell lines), which allows to hope for a sufficiently large "therapeutic window". A study of the interaction of this compound with HeLa cells shows that the substance penetrates the cell and, after red light irradiation induces ROS appearance inside the cell, associated, apparently, with the photogeneration of singlet oxygen. These data indicate that photoinduced toxic effects are caused by damage to intracellular structures as a result of oxidative stress. Programmed type of cell death characterized with caspase-3 induction is prevailing. So, the conjugate of chlorin e6 with pentaethylene glycol is a promising antitumor PS that can be successfully solubilized with Tween 80, which makes it suitable for further in vivo studies.

Macrophage-mannose-receptor-targeted photoactivatable agent for in vivo imaging and treatment of atherosclerosis.

Previous studies have demonstrated the effects of theranostic agents on atherosclerotic plaques. However, there is limited information on targeted theranostics for photodynamic treatment of atherosclerosis. This study aimed to develop a macrophage-mannose-receptor-targeted photoactivatable nanoagent that regulates atherosclerosis and to evaluate its efficacy as well as safety in atherosclerotic mice. We synthesised and characterised D-mannosamine (MAN)-polyethylene glycol (PEG)-chlorin e6 (Ce6) for phototheranostic treatment of atherosclerosis. The diagnostic and therapeutic effects of MAN-PEG-Ce6 were investigated using the atherosclerotic mouse model. The hydrophobic Ce6 photosensitiser was surrounded by the hydrophilic MAN-PEG outer shell of the self-assembled nanostructure under aqueous conditions. The MAN-PEG-Ce6 was specifically internalised in macrophage-derived foam cells through receptor-mediated endocytosis. After laser irradiation, the MAN-PEG-Ce6 markedly increased singlet oxygen generation. Intravital imaging and immunohistochemistry analyses verified MAN-PEG-Ce6's specificity to plaque macrophages and its notable anti-inflammatory impact by effectively reducing mannose-receptor-positive macrophages. The toxicity assay showed that MAN-PEG-Ce6 had negligible effects on the biochemical profile and structural damage in the skin and organs. Targeted photoactivation with MAN-PEG-Ce6 thus has the potential to rapidly reduce macrophage-derived inflammatory responses in atheroma and present favourable toxicity profiles, making it a promising approach for both imaging and treatment of atherosclerosis.

Antimicrobial Potency of Fmoc-Phe-Phe Dipeptide Hydrogels with Encapsulated Porphyrin Chromophores Is a Promising Alternative in Antimicrobial Resistance.

Antimicrobial resistance (AMR) poses a significant global health risk as a consequence of misuse of antibiotics. Owing to the increasing antimicrobial resistance, it became imperative to develop novel molecules and materials with antimicrobial properties. Porphyrins and metalloporphyrins are compounds which present antimicrobial properties especially after irradiation. As a consequence, porphyrinoids have recently been utilized as antimicrobial agents in antimicrobial photodynamic inactivation in bacteria and other microorganisms. Herein, we report the encapsulation of porphyrins into peptide hydrogels which serve as delivery vehicles. We selected the self-assembling Fmoc-Phe-Phe dipeptide, a potent gelator, as a scaffold due to its previously reported biocompatibility and three different water-soluble porphyrins as photosensitizers. We evaluated the structural, mechanical and in vitro degradation properties of these hydrogels, their interaction with NIH3T3 mouse skin fibroblasts, and we assessed their antimicrobial efficacy against Gram-positive Staphylococcus aureus (S. aureus) and Gram-negative Escherichia coli (E. coli) bacteria. We found out that the hydrogels are cytocompatible and display antimicrobial efficiency against both strains with the zinc porphyrins being more efficient. Therefore, these hydrogels present a promising alternative for combating bacterial infections in the face of growing AMR concerns.

Combined Photosensitive Gene Therapy Effective Against Triple-Negative Breast Cancer in Mice Model.

Introduction: Tumor hypoxia and invasion present significant challenges for the efficacy of photodynamic therapy (PDT) in triple-negative breast cancer (TNBC). This study developed a mitochondrial targeting strategy that combined PDT and gene therapy to promote each other and address the challenges. Methods: The positively charged amphiphilic material triphenylphosphine-tocopherol polyethylene glycol succinate (TPP-TPGS, TPS) and the photosensitizer chloride e6 (Ce6) formed TPS@Ce6 nanoparticles (NPs) by hydrophobic interaction. They electrostatically condensed microRNA-34a (miR-34a) to form stable TPS@Ce6/miRNA NPs. Results: Firstly, Ce6 disrupted the lysosomal membrane, followed by successful delivery of miR-34a by TPS@Ce6/miRNA NPs. Meanwhile, miR-34a reduced ROS depletion and further enhanced the effectiveness of PDT. Consequently, the mutual promotion between PDT and gene therapy led to enhanced anti-tumor effects. Furthermore, the TPS@Ce6/miRNA NPs promoted apoptosis by down-regulating Caspase-3 and inhibited tumor cell migration and invasion by down-regulating N-Cadherin. In addition, in vitro and in vivo experiments demonstrated that the TPS@Ce6/miRNA NPs achieved excellent anti-tumor effects. These findings highlighted the enhanced anticancer effects and reduced migration of tumor cells through the synergistic effects of PDT and gene therapy. Conclusion: Taken together, the targeted co-delivery of Ce6 and miR-34a will facilitate the application of photodynamic and genic nanomedicine in the treatment of aggressive tumors, particularly TNBC.

Covalent organic frameworks-derived carbon nanospheres based nanoplatform for tumor specific synergistic therapy via oxidative stress amplification and calcium overload.

Combinational therapy in cancer treatment that integrates the merits of different therapies is an effective approach to improve therapeutic outcomes. Herein, a simple nanoplatform (N-CNS-CaO2-HA/Ce6 NCs) that synergized chemodynamic therapy (CDT), photodynamic therapy (PDT), photothermal therapy (PTT), and Ca2+ interference therapy (CIT) has been developed to combat hypoxic tumors. With high photothermal effect, excellent peroxidase-like activity, and inherent mesoporous structure, N-doped carbon nanospheres (N-CNSs) were prepared via in situ pyrolysis of an established nanoscale covalent organic frameworks (COFs) precursor. These N-CNSs acted as PTT/CDT agents and carriers for the photosensitizer chlorin e6 (Ce6), thereby yielding a minimally invasive PDT/PTT/CDT synergistic therapy. Hyaluronic acid (HA)-modified CaO2 nanoparticles (CaO2-HA NPs) coated on the surface of the nanoplatform endowed the nanoplatform with O2/H2O2 self-supply capability to respond to and modulate the tumor microenvironment (TME), which greatly facilitated the tumor-specific performance of CDT and PDT. Moreover, the reactive oxygen species (ROS) produced during PDT and CDT enhanced the Ca2+ overloading due to CaO2 decomposition, amplifying the intracellular oxidative stress and leading to mitochondrial dysfunction. Notably, the HA molecules not only increased the cancer-targeting efficiency but also prevented CaO2 degradation during blood circulation, providing double insurance of tumor-selective CIT. Such a nanotherapeutic system possessed boosted antitumor efficacy with minimized systemic toxicity and showed great potential for treating hypoxic tumors.

Activity-Based Nitric Oxide-Responsive Porphyrin for Site-Selective and Nascent Cancer Ablation.

Nitric oxide (NO) generated within the tumor microenvironment is an established driver of cancer progression and metastasis. Recent efforts have focused on leveraging this feature to target cancer through the development of diagnostic imaging agents and activatable chemotherapeutics. In this context, porphyrins represent an extraordinarily promising class of molecules, owing to their demonstrated use within both modalities. However, the remodeling of a standard porphyrin to afford a responsive chemical that can distinguish elevated NO from physiological levels has remained a significant research challenge. In this study, we employed a photoinduced electron transfer strategy to develop a panel of NO-activatable porphyrin photosensitizers (NOxPorfins) augmented with real-time fluorescence monitoring capabilities. The lead compound, NOxPorfin-1, features an o-phenylenediamine trigger that can effectively capture NO (via N2O3) to yield a triazole product that exhibits a 7.5-fold enhancement and a 70-fold turn-on response in the singlet oxygen quantum yield and fluorescence signal, respectively. Beyond demonstrating excellent in vitro responsiveness and selectivity toward NO, we showcase the potent photodynamic therapy (PDT) effect of NOxPorfin-1 in murine breast cancer and human non-small cellular lung cancer cells. Further, to highlight the in vivo efficacy, two key studies were executed. First, we utilized NOxPorfin-1 to ablate murine breast tumors in a site-selective manner without causing substantial collateral damage to healthy tissue. Second, we established a nascent human lung cancer model to demonstrate the unprecedented ability of NOxPorfin-1 to halt tumor growth and progression completely. The results of the latter study have tremendous implications for applying PDT to target metastatic lesions.

Delocalization Engineering of Heme-Mimetic Artificial Enzymes for Augmented Reactive Oxygen Catalysis.

Developing artificial enzymes based on organic molecules or polymers for reactive oxygen species (ROS)-related catalysis has broad applicability. Herein, inspired by porphyrin-based heme mimics, we report the synthesis of polyphthalocyanine-based conjugated polymers (Fe-PPc-AE) as a new porphyrin-evolving structure to serve as efficient and versatile artificial enzymes for augmented reactive oxygen catalysis. Owing to the structural advantages, such as enhanced π-conjugation networks and π-electron delocalization, promoted electron transfer, and unique Fe-N coordination centers, Fe-PPc-AE showed more efficient ROS-production activity in terms of Vmax and turnover numbers as compared with porphyrin-based conjugated polymers (Fe-PPor-AE), which also surpassed reported state-of-the-art artificial enzymes in their activity. More interestingly, by changing the reaction medium and substrates, Fe-PPc-AE also revealed significantly improved activity and environmental adaptivity in many other ROS-related biocatalytic processes, validating the potential of Fe-PPc-AE to replace conventional (poly)porphyrin-based heme mimics for ROS-related catalysis, biosensors, or biotherapeutics. It is suggested that this study will offer essential guidance for designing artificial enzymes based on organic molecules or polymers.

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

Self-assembled porphyrin-peptide cages for photodynamic therapy.

The development of photodynamic therapy requires access to smart photosensitizers which combine appropriate photophysical and biological properties. Interestingly, supramolecular and dynamic covalent chemistries have recently shown their ability to produce novel architectures and responsive systems through simple self-assembly approaches. Herein, we report the straightforward formation of porphyrin-peptide conjugates and cage compounds which feature on their surface chemical groups promoting cell uptake and specific organelle targeting. We show that they self-assemble, in aqueous media, into positively-charged nanoparticles which generate singlet oxygen upon green light irradiation, while also undergoing a chemically-controlled disassembly due to the presence of reversible covalent linkages. Finally, the biological evaluation in cells revealed that they act as effective photosensitizers and promote synergistic effects in combination with Doxorubicin.

Microemulsion-Assisted Self-Assembly of Indium Porphyrin Photosensitizers with Enhanced Photodynamic Therapy.

Designing and constructing supramolecular photosensitizer nanosystems with highly efficient photodynamic therapy (PDT) is vital in the nanomedical field. Despite recent advances in forming well-defined superstructures, the relationship between molecular arrangement in nanostructures and photodynamic properties has rarely been involved, which is crucial for developing stable photosensitizers for highly efficient PDT. In this work, through a microemulsion-assisted self-assembly approach, indium porphyrin (InTPP) was used to fabricate a series of morphology-controlled self-assemblies, including nanorods, nanospheres, nanoplates, and nanoparticles. They possessed structure-dependent 1O2 generation efficiency. Compared with the other three nanostructures, InTPP nanorods featuring strong π-π stacking, J-aggregation, and high crystallinity proved to be much more efficient at singlet oxygen (1O2) production. Also, theoretical modeling and photophysical experiments verified that the intermolecular π-π stacking in the nanorods could cause a decreased singlet-triplet energy gap (ΔEST) compared with the monomer. This played a key role in enhancing intersystem crossing and facilitating 1O2 generation. Both in vitro and in vivo experiments demonstrated that the InTPP nanorods could trigger cell apoptosis and tumor ablation upon laser irradiation (635 nm, 0.1 W/cm2) and exhibited negligible dark toxicity and high phototoxicity. Thus, the supramolecular self-assembly strategy provides an avenue for designing high-performance photosensitizer nanosystems for photodynamic therapy and beyond.

Amphiphilic Janus nanoparticles for nitric oxide synergistic photodynamic eradication of MRSA biofilms.

Biofilms pose significant threats to public health by causing persistent clinical infections. The development of innovative antibacterial approaches for eliminating biofilms is an urgent necessity. In this study, we developed amphiphilic Janus nanoparticles (JNPs), loaded with hydrophobic chlorin e6 (Ce6) and hydrophilic S-nitrosoglutathione (GSNO), denoted as Ce6-PDA/CaP-GSNO, with the aim to effectively eradicate biofilms and combat methicillin-resistant Staphylococcus aureus (MRSA) infections through nitric oxide (NO) synergistic photodynamic therapy (PDT). Ce6-PDA/CaP-GSNO demonstrated remarkable biofilm penetration ability, efficiently reaching the acidic inner layers, which triggered the rapid release of GSNO, resulting in the generation of an abundant supply of NO. NO not only exhibited potent bactericidal activity but also effectively lowered the GSH level of the biofilm, leading to enhanced efficacy of Ce6. Additionally, the interaction between NO and reactive oxygen species (ROS) resulted in the generation of reactive nitrogen species (RNS), further enhancing PDT efficacy both in vitro and in vivo. In summary, Ce6-PDA/CaP-GSNO demonstrated remarkable biofilm penetration capacity and effective reduction of the GSH level in the biofilms, leading to enhanced PDT efficacy at low photosensitizer doses and laser intensities, thereby minimizing adverse effects on normal tissues. These findings highlight the promising potential of our approach for combating biofilm-related infections.